Stem-loop sequence gma-MIR4373

AccessionMI0016518 (change log)
DescriptionGlycine max miR4373 stem-loop
Gene family MIPF0001117; MIR4380
Stem-loop
          u                       uc       u    a    c 
5' aaaaaag ugacguacguacggauugacaau  guauggu caua ggau a
   ||||||| |||||||||||||||||||||||  ||||||| |||| |||| g
3' uuuuuuc acugugugcaugccuaacuguua  cauaccg guau ccua u
          u                       ga       -    g    a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr17: 6360081-6360184 [-]
intergenic
Database links

Mature sequence gma-miR4373

Accession MIMAT0018277
Sequence

5 - 

aaguugacguacguacggauugac

 - 28

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20122185 "Prediction of novel miRNAs and associated target genes in Glycine max" Joshi T, Yan Z, Libault M, Jeong DH, Park S, Green PJ, Sherrier DJ, Farmer A, May G, Meyers BC, Xu D, Stacey G BMC Bioinformatics. 11 Suppl 1:S14(2010).