Stem-loop sequence gma-MIR4370

AccessionMI0016512 (change log)
DescriptionGlycine max miR4370 stem-loop
Stem-loop
                uc   u     g       g 
5' cggaguagacucg  cga uuugc uagacuu g
   |||||||||||||  ||| ||||| |||||||  
3' gccucgucugagc  gcu agaug guuugaa a
                --   c     g       c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr11: 28937222-28937287 [+]
intergenic
Database links

Mature sequence gma-miR4370

Accession MIMAT0018271
Sequence

4 - 

aguagacucguccgauuuugcgua

 - 27

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20122185 "Prediction of novel miRNAs and associated target genes in Glycine max" Joshi T, Yan Z, Libault M, Jeong DH, Park S, Green PJ, Sherrier DJ, Farmer A, May G, Meyers BC, Xu D, Stacey G BMC Bioinformatics. 11 Suppl 1:S14(2010).