Stem-loop sequence gma-MIR4371c

AccessionMI0016509 (change log)
DescriptionGlycine max miR4371c stem-loop
Gene family MIPF0001141; MIR4371
Stem-loop
   --         a                   a   ca      c    u           ccaauu     aucac 
5'   cuguuaagu augacgugacagacggaau uca  ucauca guuu gucauggacac      gucau     c
     ||||||||| ||||||||||||||||||| |||  |||||| |||| |||||||||||      |||||     a
3'   ggcaauuua uacugcauuguuuguuuua agu  aguagu caag uagugccugug      cagua     c
   aa         c                   c   ac      a    u           ------     acuuc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr5: 2489793-2489939 [-]
intergenic
Database links

Mature sequence gma-miR4371c

Accession MIMAT0018268
Sequence

13 - 

gacgugacagacggaauaucacau

 - 36

Get sequence
Evidence experimental; Illumina [1-2]

References

1
PMID:20122185 "Prediction of novel miRNAs and associated target genes in Glycine max" Joshi T, Yan Z, Libault M, Jeong DH, Park S, Green PJ, Sherrier DJ, Farmer A, May G, Meyers BC, Xu D, Stacey G BMC Bioinformatics. 11 Suppl 1:S14(2010).
2