Stem-loop sequence gma-MIR4364a

AccessionMI0016501 (change log)
DescriptionGlycine max miR4364a stem-loop
Gene family MIPF0001165; MIR4364
Stem-loop
      u                      c                -      cca    
5' aac gcggaagaaccuucuuccgugc aucuugcggaagaacu ucuucc   gga 
   ||| |||||||||||||||||||||| |||||||||||||||| ||||||   || a
3' uug cgccuucuuggaagaaggcacg uagagcgccuucuugg agaagg   ccg 
      u                      c                u      -ca    
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr13: 2006154-2006264 [+]
intergenic
Database links

Mature sequence gma-miR4364a

Accession MIMAT0018260
Sequence

77 - 

cgcgagaucgcacggaagaagguu

 - 100

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20122185 "Prediction of novel miRNAs and associated target genes in Glycine max" Joshi T, Yan Z, Libault M, Jeong DH, Park S, Green PJ, Sherrier DJ, Farmer A, May G, Meyers BC, Xu D, Stacey G BMC Bioinformatics. 11 Suppl 1:S14(2010).