Stem-loop sequence gma-MIR4362

AccessionMI0016499 (change log)
DescriptionGlycine max miR4362 stem-loop
Stem-loop
           u   c             c            c    u          u   c  ca         ccugaacauuuugguucaugaaugu 
5' aacuuuua aaa caguguuuuuagu ccuuaggacaga guca guaggaaaca ugu aa  guguuuguc                         u
   |||||||| ||| ||||||||||||| |||||||||||| |||| |||||||||| ||| ||  |||||||||                          
3' uugaaaau uuu guuacgaaaauca ggaguccuguuu cggu cauccuuugu aca uu  uacagacag                         u
           u   a             a            a    u          u   a  ag         aacucccggauuuuugggaacgaaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr13: 36082340-36082537 [+]
intergenic
Database links

Mature sequence gma-miR4362

Accession MIMAT0018258
Sequence

28 - 

ccuuaggacagacgucauguag

 - 49

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20122185 "Prediction of novel miRNAs and associated target genes in Glycine max" Joshi T, Yan Z, Libault M, Jeong DH, Park S, Green PJ, Sherrier DJ, Farmer A, May G, Meyers BC, Xu D, Stacey G BMC Bioinformatics. 11 Suppl 1:S14(2010).