Stem-loop sequence gma-MIR4360

AccessionMI0016493 (change log)
DescriptionGlycine max miR4360 stem-loop
Gene family MIPF0001117; MIR4380
        c                            g   g 
5' aaaaa aguugacguacguacggauugacaaucc uau g
   ||||| |||||||||||||||||||||||||||| |||  
3' uuuuu ucaacugcaugcaugccuaacuguuagg aua c
        u                            a   c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr4: 6566470-6566549 [-]
Database links

Mature sequence gma-miR4360

Accession MIMAT0018252

6 - 


 - 29

Get sequence
Evidence experimental; Illumina [1]


PMID:20122185 "Prediction of novel miRNAs and associated target genes in Glycine max" Joshi T, Yan Z, Libault M, Jeong DH, Park S, Green PJ, Sherrier DJ, Farmer A, May G, Meyers BC, Xu D, Stacey G BMC Bioinformatics. 11 Suppl 1:S14(2010).