Stem-loop sequence gma-MIR4354

AccessionMI0016487 (change log)
DescriptionGlycine max miR4354 stem-loop
Gene family MIPF0001306; MIR4354
Stem-loop
          a   a     c      c      c          - c      guuugaccaagucaucucgagucu 
5' uuggucg guu gaccg uccaau gggauc ggugaccuaa c ggucga                        a
   ||||||| ||| ||||| |||||| |||||| |||||||||| | ||||||                         
3' agccggc caa cuggc agguua cccuag ccacuggauu g cuagcu                        u
          -   c     u      a      a          a u      aauaugauaaucuagccagugcau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr9: 42023868-42024017 [+]
intergenic
Database links

Mature sequence gma-miR4354

Accession MIMAT0018246
Sequence

126 - 

caauuggaucgguccaaccggc

 - 147

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20122185 "Prediction of novel miRNAs and associated target genes in Glycine max" Joshi T, Yan Z, Libault M, Jeong DH, Park S, Green PJ, Sherrier DJ, Farmer A, May G, Meyers BC, Xu D, Stacey G BMC Bioinformatics. 11 Suppl 1:S14(2010).