![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence hvu-MIR159a |
|||||
Accession | MI0016452 (change log) | ||||
Description | Hordeum vulgare miR159a stem-loop | ||||
Gene family | MIPF0000010; MIR159 | ||||
Literature search |
![]()
13 open access papers mention hvu-MIR159a | ||||
Stem-loop |
g ug a u uga - uac ga u -u a g u guuc uau auuag 5' g gagcuccu uca uccaa ag gguc cg aggg uug gc gcu cuug ucaug ccac ccuaucucc a | |||||||| ||| ||||| || |||| || |||| ||| || ||| |||| ||||| |||| ||||||||| 3' c cucgaggg agu agguu uc ccag gc uccc agc cg cga gagc aguac ggug ggauagagg a a gu a u -ug g -uc -- u uu c g u guuu uuc agcac |
||||
Confidence |
Annotation confidence: not enough data
| ||||
Genome context |
|
||||
Database links |
|
Mature sequence hvu-miR159a |
|
Accession | MIMAT0018210 |
Sequence |
156 - uuuggauugaagggagcucug - 176 |
Evidence | not experimental |
References |
|
1 |
PMID:18521122
"Data mining for miRNAs and their targets in the Triticeae"
Genome. 51:433-443(2008).
|
2 |
PMID:20676715
"Regulation of barley miRNAs upon dehydration stress correlated with target gene expression"
Funct Integr Genomics. 10:493-507(2010).
|
3 |
PMID:23324356
"Developmentally regulated expression and complex processing of barley pri-microRNAs"
BMC Genomics. 14:34(2013).
|