Stem-loop sequence hsa-mir-3913-2

AccessionMI0016418 (change log)
Symbol HGNC:MIR3913-2
DescriptionHomo sapiens miR-3913-2 stem-loop
Gene family MIPF0001134; mir-3913
Stem-loop
   u  c                                            g 
5'  gu uauaauaaacugaaauauuugggacugaucuugaugucugccaa g
    || ||||||||||||||||||||||||||||||||||||||||||||  
3'  ca auauuauuugacuuuauaaacccugacuagaacuacagacgguu u
   a  a                                            u 
Get sequence
Deep sequencing
1941 reads, 4.35 reads per million, 138 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr12: 69584723-69584822 [+]
intergenic
Clustered miRNAs
< 10kb from hsa-mir-3913-2
hsa-mir-3913-1chr12: 69584722-69584823 [-]
hsa-mir-3913-2chr12: 69584723-69584822 [+]
Database links

Mature sequence hsa-miR-3913-5p

Accession MIMAT0018187
Previous IDshsa-miR-3913
Sequence

22 - 

uuugggacugaucuugaugucu

 - 43

Get sequence
Deep sequencing3628 reads, 134 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

Mature sequence hsa-miR-3913-3p

Accession MIMAT0019225
Sequence

58 - 

agacaucaagaucagucccaaa

 - 79

Get sequence
Deep sequencing226 reads, 60 experiments
Evidence not experimental
Database links
Predicted targets

References

1
PMID:20224791 "Discovery of novel microRNAs in female reproductive tract using next generation sequencing" Creighton CJ, Benham AL, Zhu H, Khan MF, Reid JG, Nagaraja AK, Fountain MD, Dziadek O, Han D, Ma L, Kim J, Hawkins SM, Anderson ML, Matzuk MM, Gunaratne PH PLoS One. 5:e9637(2010).