![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence hsa-mir-3913-1 |
||||||
Accession | MI0016417 (change log) | |||||
Symbol | HGNC:MIR3913-1 | |||||
Description | Homo sapiens miR-3913-1 stem-loop | |||||
Gene family | MIPF0001134; mir-3913 | |||||
Stem-loop |
u a 5' uguuuauaauaaacugaaauauuugggacugaucuugaugucugccaa a |||||||||||||||||||||||||||||||||||||||||||||||| 3' acagauauuauuugacuuuauaaacccugacuagaacuacagacgguu c g c |
|||||
Deep sequencing |
| |||||
Confidence |
Annotation confidence: not enough data
| |||||
Genome context |
|
|||||
Clustered miRNAs |
|
|||||
Database links |
|
Mature sequence hsa-miR-3913-5p |
|
Accession | MIMAT0018187 |
Previous IDs | hsa-miR-3913 |
Sequence |
23 - uuugggacugaucuugaugucu - 44 |
Deep sequencing | 3628 reads, 134 experiments |
Evidence | experimental; Illumina [1] |
Database links |
|
Predicted targets |
|
Mature sequence hsa-miR-3913-3p |
|
Accession | MIMAT0019225 |
Sequence |
59 - agacaucaagaucagucccaaa - 80 |
Deep sequencing | 226 reads, 60 experiments |
Evidence | not experimental |
Database links |
|
Predicted targets |
|
References |
|
1 |
PMID:20224791
"Discovery of novel microRNAs in female reproductive tract using next generation sequencing"
PLoS One. 5:e9637(2010).
|
2 |
PMID:21199797
"Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene"
Cancer Res. 71:78-86(2011).
|