Stem-loop sequence hsa-mir-3674

AccessionMI0016075 (change log)
Symbol HGNC:MIR3674
DescriptionHomo sapiens miR-3674 stem-loop
Literature search

4 open access papers mention hsa-mir-3674
(7 sentences)

Stem-loop 
         cu u       c  aa  uu  c      
5' acauca  a uguagaa cu  ga  gg cguuu 
   ||||||  | ||||||| ||  ||  || |||| g
3' uguagu  u acguuuu ga  cu  cc guaga 
         cu u       u  -a  uu  u
Get sequence
Deep sequencing
55 reads, 0 reads per million, 20 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr8: 1801125-1801192 [+]
sense
OTTHUMT00000374589 ; ARHGEF10-003; intron 2
OTTHUMT00000374590 ; ARHGEF10-002; intron 2
OTTHUMT00000374591 ; ARHGEF10-001; intron 3
ENST00000349830 ; ARHGEF10-003; intron 2
ENST00000520359 ; ARHGEF10-002; intron 2
ENST00000398564 ; ARHGEF10-203; intron 2
ENST00000262112 ; ARHGEF10-201; intron 2
ENST00000518288 ; ARHGEF10-001; intron 3
ENST00000398560 ; ARHGEF10-202; intron 3
Database links

Mature sequence hsa-miR-3674

Accession MIMAT0018097
Sequence

9 -  

auuguagaaccuaagauuggcc

 - 30

Get sequence
Deep sequencing50 reads, 17 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:20459673 "Analysis of microRNA transcriptome by deep sequencing of small RNA libraries of peripheral blood" Vaz C, Ahmad HM, Sharma P, Gupta R, Kumar L, Kulshreshtha R, Bhattacharya A BMC Genomics. 11:288(2010).