![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence hsa-mir-3658 |
|||||
Accession | MI0016058 (change log) | ||||
Symbol | HGNC:MIR3658 | ||||
Description | Homo sapiens miR-3658 stem-loop | ||||
Literature search |
2 open access papers mention hsa-mir-3658 | ||||
Stem-loop |
-uu caccau g u 5' uau aagaaaa ggagau aaa g ||| ||||||| |||||| ||| 3' aug uucuuuu uuuuua uuu c uuu -----u g c |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: not enough data
| ||||
Genome context |
|
||||
Database links |
Mature sequence hsa-miR-3658 |
|
Accession | MIMAT0018078 |
Sequence |
3 - uuuaagaaaacaccauggagau - 24 |
Deep sequencing | 5 reads, 5 experiments |
Evidence | experimental; 454 [1] |
Predicted targets |
|
References |
|
1 |
PMID:20483914
"Discovery of microRNAs and other small RNAs in solid tumors"
Nucleic Acids Res. 38:6234-6246(2010).
|