Stem-loop sequence hsa-mir-3646

Accession

MI0016046 (change log)

Symbol

HGNC:MIR3646

Description

Homo sapiens miR-3646 stem-loop

Literature search

4 open access papers mention hsa-mir-3646
(67 sentences)

Stem-loop

   u     a                      ug   ---a   u 
5'  ucagu gguuggguucauuucauuuuca  aca    ccc a
    ||||| ||||||||||||||||||||||  |||    ||| u
3'  aguua ccgacccgaguaaaguaaaagu  ugu    ggg a
   a     c                      gu   aaaa   u 

Deep sequencing

15 reads, 18.2 reads per million, 11 experiments

Confidence

Annotation confidence: not enough data

Feedback: Do you believe this miRNA is real?

Genome context

• Coordinates (GRCh38; GCA_000001405.15): chr20: 44408120-44408203 [+]
• Overlapping transcripts:

  antisense

  OTTHUMT00000079513 ; WFDC3-006; intron 1

  OTTHUMT00000316864 ; WFDC3-013; intron 1

  OTTHUMT00000079509 ; WFDC3-002; intron 1

  OTTHUMT00000316861 ; WFDC3-010; intron 2

  OTTHUMT00000316865 ; WFDC3-014; intron 2

  OTTHUMT00000316860 ; WFDC3-009; intron 2

  OTTHUMT00000079512 ; WFDC3-005; intron 2

  OTTHUMT00000316862 ; WFDC3-011; intron 2

  OTTHUMT00000079510 ; WFDC3-003; intron 3

  OTTHUMT00000316859 ; WFDC3-008; intron 3

  OTTHUMT00000079508 ; WFDC3-001; intron 4

  OTTHUMT00000316858 ; WFDC3-007; intron 4

  ENST00000474942 ; WFDC3-006; intron 1

  ENST00000372630 ; WFDC3-013; intron 1

  ENST00000471401 ; WFDC3-002; intron 1

  ENST00000481847 ; WFDC3-010; intron 2

  ENST00000372632 ; WFDC3-014; intron 2

  ENST00000462017 ; WFDC3-009; intron 2

  ENST00000467679 ; WFDC3-005; intron 2

  ENST00000490877 ; WFDC3-011; intron 2

  ENST00000493693 ; WFDC3-003; intron 3

  ENST00000487343 ; WFDC3-008; intron 3

  ENST00000337205 ; WFDC3-001; intron 4

  ENST00000243938 ; WFDC3-007; intron 4

Database links

• EntrezGene:MIR3646
• HGNC:MIR3646
• miRBase Tracker:MI0016046

Mature sequence hsa-miR-3646

• Accession: MIMAT0018065
• Sequence: 58 - aaaaugaaaugagcccagccca - 79
• Deep sequencing: 7 reads, 6 experiments
• Evidence: experimental; 454 [1]
• Predicted targets:
  • TargetMiner:hsa-miR-3646
  • TargetScanVert:hsa-miR-3646
  • miRDB:hsa-miR-3646

References

1. PMID:20483914 "Discovery of microRNAs and other small RNAs in solid tumors" Meiri E, Levy A, Benjamin H, Ben-David M, Cohen L, Dov A, Dromi N, Elyakim E, Yerushalmi N, Zion O, Lithwick-Yanai G, Sitbon E Nucleic Acids Res. 38:6234-6246(2010).