Stem-loop sequence hsa-mir-3622a

Accession

MI0016013 (change log)

Symbol

HGNC:MIR3622A

Description

Homo sapiens miR-3622a stem-loop

Gene family

MIPF0001179; mir-3622

Literature search

5 open access papers mention hsa-mir-3622a
(10 sentences)

Stem-loop

                      c     c         -g   g 
5' aauagagggugcacaggca gggag ucaggugag  cag g
   ||||||||||||||||||| ||||| |||||||||  |||  
3' uuaucucccacguguccgu cccuc aguccacuc  guc a
                      a     c         ga   g 

Deep sequencing

671 reads, 5 reads per million, 100 experiments

Confidence

Annotation confidence: high

Feedback: Do you believe this miRNA is real?

Genome context

• Coordinates (GRCh38; GCA_000001405.15): chr8: 27701677-27701759 [+]
• Overlapping transcripts:

  intergenic

Clustered miRNAs

< 10kb from hsa-mir-3622a

• hsa-mir-3622b: chr8: 27701673-27701767 [-]
• hsa-mir-3622a: chr8: 27701677-27701759 [+]

Database links

• EntrezGene:MIR3622A
• HGNC:MIR3622A
• RNAcentral:URS000075D590_9606
• miRBase Tracker:MI0016013

Mature sequence hsa-miR-3622a-5p

• Accession: MIMAT0018003
• Sequence: 14 - caggcacgggagcucaggugag - 35
• Deep sequencing: 513 reads, 81 experiments
• Evidence: experimental; Illumina [1-2]
• Database links:
  • RNAcentral:URS00003B59DF_9606
• Predicted targets:
  • TargetMiner:hsa-miR-3622a-5p
  • TargetScanVert:hsa-miR-3622a-5p
  • miRDB:hsa-miR-3622a-5p

Mature sequence hsa-miR-3622a-3p

• Accession: MIMAT0018004
• Sequence: 50 - ucaccugaccucccaugccugu - 71
• Deep sequencing: 138 reads, 54 experiments
• Evidence: experimental; Illumina [1-2]
• Predicted targets:
  • TargetMiner:hsa-miR-3622a-3p
  • TargetScanVert:hsa-miR-3622a-3p
  • miRDB:hsa-miR-3622a-3p

References

1. PMID:20459774 "Ultra-high throughput sequencing-based small RNA discovery and discrete statistical biomarker analysis in a collection of cervical tumours and matched controls" Witten D, Tibshirani R, Gu SG, Fire A, Lui WO BMC Biol. 8:58(2010).
2. PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).