Stem-loop sequence hsa-mir-3621

AccessionMI0016012 (change log)
Symbol HGNC:MIR3621
DescriptionHomo sapiens miR-3621 stem-loop
Literature search

1 open access papers mention hsa-mir-3621
(2 sentences)

Stem-loop 
   gugagcug   -       ------    -   g   ugcag      gc 
5'         cug gggacgc      gggu cgg guc     ggcggu  g
           ||| |||||||      |||| ||| |||     ||||||   
3'         gac cccugug      uccg gcc cag     ccgccg  g
   --------   a       ucuguu    c   g   -ucca      ac
Get sequence
Deep sequencing
538 reads, 0 reads per million, 75 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr9: 137169186-137169270 [-]
intergenic
Database links

Mature sequence hsa-miR-3621

Accession MIMAT0018002
Sequence

16 -  

cgcgggucggggucugcagg

 - 35

Get sequence
Deep sequencing535 reads, 76 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:20459774 "Ultra-high throughput sequencing-based small RNA discovery and discrete statistical biomarker analysis in a collection of cervical tumours and matched controls" Witten D, Tibshirani R, Gu SG, Fire A, Lui WO BMC Biol. 8:58(2010).