![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence hsa-mir-3614 |
|||||
Accession | MI0016004 (change log) | ||||
Symbol | HGNC:MIR3614 | ||||
Description | Homo sapiens miR-3614 stem-loop | ||||
Literature search |
![]()
9 open access papers mention hsa-mir-3614 | ||||
Stem-loop |
gguucuguc ug gc u uuug 5' u g cacu ggaucugaaggcugcccc c | | |||| |||||||||||||||||| 3' a u gugg ucuagacuuccgaugggg u ucauucuua gu uu u ucuc |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: high
| ||||
Genome context |
|
||||
Database links |
|
Mature sequence hsa-miR-3614-5p |
|
Accession | MIMAT0017992 |
Sequence |
15 - ccacuuggaucugaaggcugccc - 37 |
Deep sequencing | 596 reads, 69 experiments |
Evidence | experimental; Illumina [1-3] |
Database links |
|
Predicted targets |
|
Mature sequence hsa-miR-3614-3p |
|
Accession | MIMAT0017993 |
Sequence |
53 - uagccuucagaucuugguguuuu - 75 |
Deep sequencing | 236 reads, 70 experiments |
Evidence | experimental; Illumina [1-3] |
Database links |
|
Predicted targets |
|
References |
|
1 | |
2 |
PMID:21199797
"Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene"
Cancer Res. 71:78-86(2011).
|
3 |
PMID:21807764
"Deep sequencing of small RNAs from human skin reveals major alterations in the psoriasis miRNAome"
Hum Mol Genet. 20:4025-4040(2011).
|