![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence hsa-mir-1972-2 |
|||||
Accession | MI0015977 (change log) | ||||
Symbol | HGNC:MIR1972-2 | ||||
Description | Homo sapiens miR-1972-2 stem-loop | ||||
Gene family | MIPF0001025; mir-1972 | ||||
Literature search |
![]()
10 open access papers mention hsa-mir-1972-2 | ||||
Stem-loop |
u caca a guguc 5' uauaggcaug gccac ccuggcuu aau a |||||||||| ||||| |||||||| ||| u 3' auguccguac cggug ggaccgga uua u u acac c aaaau |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: not enough data
| ||||
Genome context |
|
||||
Database links |
|
Mature sequence hsa-miR-1972 |
|
Accession | MIMAT0009447 |
Sequence |
48 - ucaggccaggcacaguggcuca - 69 |
Deep sequencing | 1354 reads, 121 experiments |
Evidence | experimental; cloned [1] |
Database links |
|
Predicted targets |
|
References |
|
1 |
PMID:18923441
"Identification of new microRNA genes and aberrant microRNA profiles in childhood acute lymphoblastic leukemia"
Leukemia. 23:313-322(2009).
|