Stem-loop sequence hsa-mir-4285

AccessionMI0015891 (change log)
Symbol HGNC:MIR4285
DescriptionHomo sapiens miR-4285 stem-loop
Literature search

1 open access papers mention hsa-mir-4285
(2 sentences)

Stem-loop
   auuaggcggggcggcgaguccgacucauaaauauuuuaaggaauga   g    uggg      a 
5'                                               ccc gccc    gugcgg a
                                                 ||| ||||    |||||| u
3'                                               ggg cggg    cgcguc u
   --------------------------------------------cg   g    ----      g 
Get sequence
Deep sequencing
115 reads, 7.14 reads per million, 28 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr7: 102293103-102293187 [+]
sense
OTTHUMT00000350899 ; SPDYE2L-001; intron 2
ENST00000436228 ; SPDYE2B-201; intron 1
ENST00000507450 ; SPDYE2B-001; intron 2
antisense
OTTHUMT00000453068 ; RP11-577H5.5-001; intron 4
ENST00000333432 ; POLR2J2-201; intron 3
ENST00000591000 ; POLR2J2-202; intron 4
ENST00000476151 ; POLR2J2-001; intron 4
Database links

Mature sequence hsa-miR-4285

Accession MIMAT0016913
Sequence

11 - 

gcggcgaguccgacucau

 - 28

Get sequence
Deep sequencing13 reads, 11 experiments
Evidence experimental; SOLiD [1]
Predicted targets

References

1
PMID:19784364 "Ago2 immunoprecipitation identifies predicted microRNAs in human embryonic stem cells and neural precursors" Goff LA, Davila J, Swerdel MR, Moore JC, Cohen RI, Wu H, Sun YE, Hart RP PLoS One. 4:e7192(2009).