Stem-loop hsa-mir-3188

Accession

MI0014232

Symbol

HGNC: MIR3188

Description

Homo sapiens hsa-mir-3188 precursor miRNA

Gene family

MIPF0001488; mir-3188

Summary

Caution, this is an AI generated summary based on literature. This may have errors.

MIR3188 is a microRNA that has been found to regulate the mTOR and PI3K/AKT pathway involved in insulin signaling in endothelial cells [PMC8673831]. The reduced expression of MIR3188, due to the presence of rs7247237, has been associated with the development of type 2 diabetes mellitus (T2DM) [PMC8673831]. In nasopharyngeal carcinoma (NPC), MIR3188 is one of the downregulated miRNAs, and its decreased expression is associated with a good prognosis [PMC6368411]. Additionally, MIR3188 has been identified as a potential therapeutic target for non-small cell lung cancer (NSCLC) treatment [PMC6297856]. The functional importance of MIR3188 has been inferred using a systems biology tool called miRUPnet, which revealed that its target genes are critical in several cancer pathways and its most significant gene ontology term is chromatin binding [PMC4371809]. In iAs-T cells, the gene expression levels of OPN3 and MIR3188 were upregulated, but they were downregulated in iAs-Rev cells [PMC4371809]. Common genes found in all three conditions include microfibrillar associated protein 5 (MFAP5), phospholipase C-like 1 (PLCL1), opsin 3 (OPN3), and peroxisomal biogenesis factor 11 alpha (PEX11A) [PMC4371809]. Overall, MIR3188 plays important roles in insulin signaling, cancer prognosis, and potential therapeutic strategies for T2DM, NPC, NSCLC treatment. Accurate identification and quantification of intracellular MIR3188 are crucial for further research and prognosis of NPC [PMC8695942].

Literature search

2 open access papers mention hsa-mir-3188
(3 sentences)

Sequence

274 reads, 36 reads per million, 48 experiments

ggcgccuccugcucugcugugccgccagggccuccccuagcgcgccuucuggAGAGGCUUUGUGCGGAUACGGGGcuggaggccu
...((((((.((((((.(((.(((((((((((((.((.((........)))).))))))))).))))))))))))).))))))..

Structure

ggc      u      c   g    -         c  u  cgc 
   gccucc gcucug ugu ccgc cagggccuc cc ag   g
   |||||| |||||| ||| |||| ||||||||| || ||    
   cggagg cGGGGC AUA GGCG GUUUCGGAG gg uc   c
-uc      u      -   -    U         A  -  uuc 

Annotation confidence Not enough data

Genome context

chr19: 18282077-18282161 [+]

Mature hsa-miR-3188

• Accession: MIMAT0015070
• Description: Homo sapiens hsa-miR-3188 mature miRNA
• Sequence: 53 - AGAGGCUUUGUGCGGAUACGGGG - 75
• Evidence: experimental ; Illumina [1]

References

1. PubMed ID: 20300190
   Characterization of the Melanoma miRNAome by Deep Sequencing
   "Stark MS, Tyagi S, Nancarrow DJ, Boyle GM, Cook AL, Whiteman DC, Parsons PG, Schmidt C, Sturm RA, Hayward NK"
   "PLoS One (2010) 5:e9685