miRBase entry: hsa-mir-3180-2

Stem-loop hsa-mir-3180-2


Accession
MI0014215
Symbol
HGNC: MIR3180-2
Description
Homo sapiens hsa-mir-3180-2 precursor miRNA
Gene family
MIPF0000894; mir-3180

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

MIR3180-2 is a long non-coding RNA (lncRNA) that is highly co-expressed with known Alzheimer's disease (AD)-related genes, such as S100B, AGT, and NTS [PMC7047416]. It has been found that MIR3180-2 and MIR3180-3 target protein-coding genes (PCGs) involved in the neuroprotective role of THOP1 in AD and blood vessel remodeling [PMC7047416]. Additionally, MIR3180-2 and MIR3180-3 share co-expressed PCGs with known AD-related PCGs, including VTI1A, CUX1, S100B, AGT, NTS, and IRAK4 [PMC7047416]. These findings suggest that MIR3180-2 may play a role in AD pathogenesis. Furthermore, MIR3180-2 is one of the top downregulated lncRNAs in AD [PMC7388310]. Co-expression network analysis has shown that MIR3180-2 is frequently co-expressed with relevant AD risk protein-coding genes [PMC8774680]. It's worth noting that disruptions in mir3180-1, MIR3180-2, and mir3180-3 have been observed along with their target genes CD44 and FAM115A in an individual from Tibet [PMC3938728]. These findings suggest that MIR31802 may have potential as a biomarker for AD.

Literature search
6 open access papers mention hsa-mir-3180-2
(60 sentences)

Sequence

4453 reads, 123 reads per million, 63 experiments
gcgacgggcggagCUUCCAGACGCUCCGCCCCACGUCGcaugcgccccgggaaagcgUGGGGCGGAGCUUCCGGAGGCCccgcccugc
(((..((((((.((((((.((.((((((((((((((....(.((...)).)...)))))))))))))).)).)))))).)))))))))

Structure
   ac      a      A  C              CGca g  c 
gcg  gggcgg gCUUCC GA GCUCCGCCCCACGU    u cg  
|||  |||||| |||||| || ||||||||||||||    | || c
cgu  cccgcc CGGAGG CU CGAGGCGGGGUgcg    g gc  
   --      C      C  U              -aaa g  c 


Annotation confidence High
Do you think this miRNA is real?

Genome context
chr16: 16309879-16309966 [+]
Clustered miRNAs
2 other miRNAs are < 10 kb from hsa-mir-3180-2
Name Accession Chromosome Start End Strand Confidence




Disease association
hsa-mir-3180-2 is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-3180-5p

Accession MIMAT0015057
Description Homo sapiens hsa-miR-3180-5p mature miRNA
Sequence 14 - CUUCCAGACGCUCCGCCCCACGUCG - 38
Evidence experimental
Illumina [1]
Database links
Predicted targets

Mature hsa-miR-3180-3p

Accession MIMAT0015058
Description Homo sapiens hsa-miR-3180-3p mature miRNA
Sequence 58 - UGGGGCGGAGCUUCCGGAGGCC - 79
Evidence experimental
Illumina [1]
Database links
Predicted targets

References

  1. PubMed ID: 20300190
    Characterization of the Melanoma miRNAome by Deep Sequencing
    "Stark MS, Tyagi S, Nancarrow DJ, Boyle GM, Cook AL, Whiteman DC, Parsons PG, Schmidt C, Sturm RA, Hayward NK"
    "PLoS One (2010) 5:e9685

  2. PubMed ID: 21199797
    Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene
    "Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C"
    "Cancer Res (2011) 71:78-86