Stem-loop sequence hsa-mir-3162

Accession

MI0014192 (change log)

Symbol

HGNC:MIR3162

Description

Homo sapiens miR-3162 stem-loop

Literature search

8 open access papers mention hsa-mir-3162
(12 sentences)

Stem-loop

              a      a  a          cau   ca 
5' cugacuuuuuu gggagu ga ggguggggag   gaa  a
   ||||||||||| |||||| || ||||||||||   |||   
3' gacugaaaaaa cccuca cu cccaucccuc   cuu  u
              c      c  c          acu   ug 

Deep sequencing

608 reads, 1.11 reads per million, 90 experiments

Confidence

Annotation confidence: not enough data

Feedback: Do you believe this miRNA is real?

Genome context

• Coordinates (GRCh38; GCA_000001405.15): chr11: 59595077-59595158 [-]
• Overlapping transcripts:

  intergenic

Database links

• EntrezGene:MIR3162
• HGNC:MIR3162
• RNAcentral:URS000075EF55_9606
• miRBase Tracker:MI0014192

Mature sequence hsa-miR-3162-5p

• Accession: MIMAT0015036
• Previous IDs: hsa-miR-3162
• Sequence: 10 - uuagggaguagaaggguggggag - 32
• Deep sequencing: 135 reads, 35 experiments
• Evidence: experimental; Illumina [1-2]
• Database links:
  • RNAcentral:URS00001E2938_9606
• Predicted targets:
  • TargetMiner:hsa-miR-3162-5p
  • TargetScanVert:hsa-miR-3162-5p
  • miRDB:hsa-miR-3162-5p
  • microrna.org:hsa-miR-3162-5p

Mature sequence hsa-miR-3162-3p

• Accession: MIMAT0019213
• Sequence: 52 - ucccuaccccuccacucccca - 72
• Deep sequencing: 466 reads, 63 experiments
• Evidence: experimental; Illumina [2]
• Predicted targets:
  • TargetMiner:hsa-miR-3162-3p
  • TargetScanVert:hsa-miR-3162-3p
  • miRDB:hsa-miR-3162-3p

References

1. PMID:20300190 "Characterization of the Melanoma miRNAome by Deep Sequencing" Stark MS, Tyagi S, Nancarrow DJ, Boyle GM, Cook AL, Whiteman DC, Parsons PG, Schmidt C, Sturm RA, Hayward NK PLoS One. 5:e9685(2010).
2. PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).