Stem-loop sequence hsa-mir-3154

Accession

MI0014182 (change log)

Symbol

HGNC:MIR3154

Description

Homo sapiens miR-3154 stem-loop

Gene family

MIPF0001387; mir-3154

Literature search

1 open access papers mention hsa-mir-3154
(1 sentences)

Stem-loop

     -      cu   ca  -          g  caccc     -a gu 
5' gg ccccuc  ucu  gc cccagcuccc cu     cugcc  c  c
   || ||||||  |||  || |||||||||| ||     |||||  |   
3' cc ggggag  aga  cg ggguugaggg ga     gacgg  g  a
     a      --   --  a          -  ----a     ag aa 

Deep sequencing

261 reads, 1.59 reads per million, 63 experiments

Confidence

Annotation confidence: not enough data

Feedback: Do you believe this miRNA is real?

Comments

Berezikov et al. proposed this sequence as a miRNA candidate based on the RAKE method [1]. Goff et al. [2] and Stark et al. [3] later validated its expression in human using high-throughput sequencing.

Genome context

• Coordinates (GRCh38; GCA_000001405.15): chr9: 128244947-128245030 [-]
• Overlapping transcripts:

  sense

  OTTHUMT00000054087 ; MAPKAP1-004; intron 1

  OTTHUMT00000355311 ; MAPKAP1-018; intron 2

  OTTHUMT00000355309 ; MAPKAP1-016; intron 5

  OTTHUMT00000054088 ; MAPKAP1-005; intron 6

  OTTHUMT00000355308 ; MAPKAP1-015; intron 8

  OTTHUMT00000054092 ; MAPKAP1-009; intron 8

  OTTHUMT00000054090 ; MAPKAP1-007; intron 8

  OTTHUMT00000054091 ; MAPKAP1-008; intron 8

  ENST00000444226 ; MAPKAP1-004; intron 1

  ENST00000496063 ; MAPKAP1-018; intron 2

  ENST00000373497 ; MAPKAP1-202; intron 4

  ENST00000497932 ; MAPKAP1-016; intron 5

  ENST00000420643 ; MAPKAP1-005; intron 6

  ENST00000394063 ; MAPKAP1-203; intron 7

  ENST00000373511 ; MAPKAP1-015; intron 8

  ENST00000373498 ; MAPKAP1-009; intron 8

  ENST00000350766 ; MAPKAP1-007; intron 8

  ENST00000373503 ; MAPKAP1-008; intron 8

  ENST00000265960 ; MAPKAP1-201; intron 9

Clustered miRNAs

< 10kb from hsa-mir-3154

• hsa-mir-3154: chr9: 128244947-128245030 [-]
• hsa-mir-199b: chr9: 128244721-128244830 [-]

Database links

• EntrezGene:MIR3154
• HGNC:MIR3154
• RNAcentral:URS000075BF1B_9606
• miRBase Tracker:MI0014182

Mature sequence hsa-miR-3154

• Accession: MIMAT0015028
• Sequence: 54 - cagaaggggaguugggagcaga - 75
• Deep sequencing: 237 reads, 54 experiments
• Evidence: experimental; SOLiD [2], Illumina [3-5]
• Database links:
  • RNAcentral:URS0000519450_9606
• Predicted targets:
  • TargetMiner:hsa-miR-3154
  • TargetScanVert:hsa-miR-3154
  • miRDB:hsa-miR-3154
  • microrna.org:hsa-miR-3154

References

1. PMID:16954537 "Many novel mammalian microRNA candidates identified by extensive cloning and RAKE analysis" Berezikov E, van Tetering G, Verheul M, van de Belt J, van Laake L, Vos J, Verloop R, van de Wetering M, Guryev V, Takada S, van Zonneveld AJ, Mano H, Plasterk R, Cuppen E Genome Res. 16:1289-1298(2006).
2. PMID:19784364 "Ago2 immunoprecipitation identifies predicted microRNAs in human embryonic stem cells and neural precursors" Goff LA, Davila J, Swerdel MR, Moore JC, Cohen RI, Wu H, Sun YE, Hart RP PLoS One. 4:e7192(2009).
3. PMID:20300190 "Characterization of the Melanoma miRNAome by Deep Sequencing" Stark MS, Tyagi S, Nancarrow DJ, Boyle GM, Cook AL, Whiteman DC, Parsons PG, Schmidt C, Sturm RA, Hayward NK PLoS One. 5:e9685(2010).
4. PMID:21606961 "Discovery of new microRNAs by small RNAome deep sequencing in childhood acute lymphoblastic leukemia" Schotte D, Akbari Moqadam F, Lange-Turenhout EA, Chen C, van Ijcken WF, Pieters R, den Boer ML Leukemia. 25:1389-1399(2011).
5. PMID:22454130 "Transcription factors are targeted by differentially expressed miRNAs in primates" Dannemann M, Prufer K, Lizano E, Nickel B, Burbano HA, Kelso J Genome Biol Evol. 4:552-564(2012).