![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence hsa-mir-3127 |
|||||
Accession | MI0014144 (change log) | ||||
Symbol | HGNC:MIR3127 | ||||
Description | Homo sapiens miR-3127 stem-loop | ||||
Gene family | MIPF0001439; mir-3127 | ||||
Literature search |
4 open access papers mention hsa-mir-3127 | ||||
Stem-loop |
g uca ug u - aga 5' ggcca gccca gggcuug gaa gggaag g a ||||| ||||| ||||||| ||| |||||| | 3' ucggu ugggu uccggac cuu cccuuc c g g -cg gu c g agg |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: high
| ||||
Genome context |
|
||||
Database links |
|
Mature sequence hsa-miR-3127-5p |
|
Accession | MIMAT0014990 |
Previous IDs | hsa-miR-3127 |
Sequence |
11 - aucagggcuuguggaaugggaag - 33 |
Deep sequencing | 1220 reads, 81 experiments |
Evidence | experimental; Illumina [1-2] |
Database links |
|
Predicted targets |
|
Mature sequence hsa-miR-3127-3p |
|
Accession | MIMAT0019201 |
Sequence |
47 - uccccuucugcaggccugcugg - 68 |
Deep sequencing | 47 reads, 26 experiments |
Evidence | experimental; Illumina [2] |
Predicted targets |
|
References |
|
1 |
PMID:20300190
"Characterization of the Melanoma miRNAome by Deep Sequencing"
PLoS One. 5:e9685(2010).
|
2 |
PMID:21199797
"Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene"
Cancer Res. 71:78-86(2011).
|