Stem-loop sequence hsa-mir-3127

AccessionMI0014144 (change log)
Symbol HGNC:MIR3127
DescriptionHomo sapiens miR-3127 stem-loop
Gene family MIPF0001439; mir-3127
Literature search

4 open access papers mention hsa-mir-3127
(8 sentences)

Stem-loop 
        g     uca       ug   u      - aga 
5' ggcca gccca   gggcuug  gaa gggaag g   a
   ||||| |||||   |||||||  ||| |||||| |    
3' ucggu ugggu   uccggac  cuu cccuuc c   g
        g     -cg       gu   c      g agg
Get sequence
Deep sequencing
1288 reads, 0 reads per million, 89 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr2: 96798278-96798353 [+]
antisense
OTTHUMT00000338801 ; ASTL-001; intron 6
ENST00000342380 ; ASTL-001; intron 6
Database links

Mature sequence hsa-miR-3127-5p

Accession MIMAT0014990
Previous IDshsa-miR-3127
Sequence

11 -  

aucagggcuuguggaaugggaag

 - 33

Get sequence
Deep sequencing1220 reads, 81 experiments
Evidence experimental; Illumina [1-2]
Database links
Predicted targets

Mature sequence hsa-miR-3127-3p

Accession MIMAT0019201
Sequence

47 -  

uccccuucugcaggccugcugg

 - 68

Get sequence
Deep sequencing47 reads, 26 experiments
Evidence experimental; Illumina [2]
Predicted targets

References

1
PMID:20300190 "Characterization of the Melanoma miRNAome by Deep Sequencing" Stark MS, Tyagi S, Nancarrow DJ, Boyle GM, Cook AL, Whiteman DC, Parsons PG, Schmidt C, Sturm RA, Hayward NK PLoS One. 5:e9685(2010).
2
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).