Stem-loop sequence hsa-mir-3117

Accession

MI0014130 (change log)

Symbol

HGNC:MIR3117

Description

Homo sapiens miR-3117 stem-loop

Gene family

MIPF0001506; mir-3117

Literature search

1 open access papers mention hsa-mir-3117
(1 sentences)

Stem-loop

      -     g   a a       c     a     ggg 
5' ccc uaaag gcc g cacuaua gaguc uauaa   a
   ||| ||||| ||| | ||||||| ||||| |||||   a
3' ggg guuuu ugg c gugauau cucag auauu   g
      u     g   a c       a     g     acg 

Deep sequencing

1856 reads, 0 reads per million, 113 experiments

Confidence

Annotation confidence: not enough data

Feedback: Do you believe this miRNA is real?

Genome context

• Coordinates (GRCh38; GCA_000001405.15): chr1: 66628440-66628517 [+]
• Overlapping transcripts:

  sense

  OTTHUMT00000025190 ; PDE4B-003; intron 1

  OTTHUMT00000388748 ; PDE4B-014; intron 1

  OTTHUMT00000388746 ; PDE4B-012; intron 2

  OTTHUMT00000388747 ; PDE4B-013; intron 2

  OTTHUMT00000025188 ; PDE4B-001; intron 3

  OTTHUMT00000025189 ; PDE4B-002; intron 3

  ENST00000423207 ; PDE4B-003; intron 1

  ENST00000412480 ; PDE4B-014; intron 1

  ENST00000532040 ; PDE4B-012; intron 2

  ENST00000526666 ; PDE4B-013; intron 2

  ENST00000371049 ; PDE4B-201; intron 2

  ENST00000329654 ; PDE4B-001; intron 3

  ENST00000341517 ; PDE4B-002; intron 3

Database links

• EntrezGene:MIR3117
• HGNC:MIR3117
• RNAcentral:URS000075E1C7_9606
• miRBase Tracker:MI0014130

Mature sequence hsa-miR-3117-5p

• Accession: MIMAT0019197
• Sequence: 13 - agacacuauacgagucauau - 32
• Deep sequencing: 13 reads, 11 experiments
• Evidence: experimental; Illumina [2-3]
• Predicted targets:
  • TargetMiner:hsa-miR-3117-5p
  • TargetScanVert:hsa-miR-3117-5p
  • miRDB:hsa-miR-3117-5p

Mature sequence hsa-miR-3117-3p

• Accession: MIMAT0014979
• Previous IDs: hsa-miR-3117
• Sequence: 46 - auaggacucauauagugccag - 66
• Deep sequencing: 1842 reads, 113 experiments
• Evidence: experimental; Illumina [1-3]
• Database links:
  • RNAcentral:URS0000507F3E_9606
• Predicted targets:
  • TargetMiner:hsa-miR-3117-3p
  • TargetScanVert:hsa-miR-3117-3p
  • miRDB:hsa-miR-3117-3p
  • microrna.org:hsa-miR-3117-3p

References

1. PMID:20300190 "Characterization of the Melanoma miRNAome by Deep Sequencing" Stark MS, Tyagi S, Nancarrow DJ, Boyle GM, Cook AL, Whiteman DC, Parsons PG, Schmidt C, Sturm RA, Hayward NK PLoS One. 5:e9685(2010).
2. PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).
3. PMID:21606961 "Discovery of new microRNAs by small RNAome deep sequencing in childhood acute lymphoblastic leukemia" Schotte D, Akbari Moqadam F, Lange-Turenhout EA, Chen C, van Ijcken WF, Pieters R, den Boer ML Leukemia. 25:1389-1399(2011).