![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence tgu-mir-455 |
|||||
Accession | MI0013840 (change log) | ||||
Description | Taeniopygia guttata miR-455 stem-loop | ||||
Gene family | MIPF0000129; mir-455 | ||||
Literature search |
1 open access papers mention tgu-mir-455 | ||||
Stem-loop |
---------gg u a c gaa 5' guaugugccc uggacu cau gug g |||||||||| |||||| ||| ||| 3' cauauacggg accuga gua cac c aacuccguuca u c c gac |
||||
Confidence |
Annotation confidence: not enough data
| ||||
Genome context |
|
||||
Database links |
|
Mature sequence tgu-miR-455-5p |
|
Accession | MIMAT0014655 |
Previous IDs | tgu-miR-455* |
Sequence |
4 - uaugugcccuuggacuacaucg - 25 |
Evidence | experimental; 454 [1], Illumina [1-2] |
Mature sequence tgu-miR-455-3p |
|
Accession | MIMAT0014610 |
Previous IDs | tgu-miR-455 |
Sequence |
41 - ugcaguccaugggcauauaca - 61 |
Evidence | experimental; 454 [1], Illumina [1-2] |
References |
|
1 |
PMID:20360741
"The genome of a songbird"
Nature. 464:757-762(2010).
|
2 |
PMID:23268654
"Genome-wide annotation and analysis of zebra finch microRNA repertoire reveal sex-biased expression"
BMC Genomics. 13:727(2012).
|