Stem-loop sequence tgu-mir-203

AccessionMI0013835 (change log)
DescriptionTaeniopygia guttata miR-203 stem-loop
Gene family MIPF0000108; mir-203
Stem-loop
   gcgggcggggagcgcgcccccgccccgcugcgcuccccgcggacccucag    c     gc         u    g    a     cuc 
5'                                                   ccuc uuggu  agugguucu aaca uuca caguu   u
                                                     |||| |||||  ||||||||| |||| |||| |||||   a
3'                                                   ggag gacca  ucaccagga uugu aagu guuaa   g
   --------------------------------------------------    c     gu         u    a    -     uac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (taeGlu3.2.4) Overlapping transcripts
chr5: 52214055-52214186 [+]
sense
ENSTGUT00000013424 ; ASPG-201; intron 15
Database links

Mature sequence tgu-miR-203-5p

Accession MIMAT0027022
Sequence

63 - 

agugguucuuaacaguucaac

 - 83

Get sequence
Evidence experimental; Illumina [2]

Mature sequence tgu-miR-203-3p

Accession MIMAT0014605
Sequence

101 - 

gugaaauguuuaggaccacuug

 - 122

Get sequence
Evidence experimental; 454 [1], Illumina [1-2]

References

1
PMID:20360741 "The genome of a songbird" Warren WC, Clayton DF, Ellegren H, Arnold AP, Hillier LW, Kunstner A, Searle S, White S, Vilella AJ, Fairley S, Heger A, Kong L, Ponting CP, Jarvis ED, Mello CV, Minx P, Lovell P, Velho TA, Ferris M, Balakrishnan CN, Sinha S, Blatti C, London SE, Li Y, Li Nature. 464:757-762(2010).
2
PMID:23268654 "Genome-wide annotation and analysis of zebra finch microRNA repertoire reveal sex-biased expression" Luo GZ, Hafner M, Shi Z, Brown M, Feng GH, Tuschl T, Wang XJ, Li X BMC Genomics. 13:727(2012).