![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence tgu-mir-29b-2 |
||||||
Accession | MI0013831 (change log) | |||||
Description | Taeniopygia guttata miR-29b-2 stem-loop | |||||
Gene family | MIPF0000009; mir-29 | |||||
Stem-loop |
------------ c g u uuucc 5' cugguuuca auggug cu agau c ||||||||| |||||| || |||| a 3' gacuaaagu uaccac ga ucua c cgaggaucuugu u - - uguuu |
|||||
Confidence |
Annotation confidence: not enough data
| |||||
Genome context |
|
|||||
Clustered miRNAs |
|
|||||
Database links |
|
Mature sequence tgu-miR-29b-2-5p |
|
Accession | MIMAT0014651 |
Previous IDs | tgu-miR-29b* |
Sequence |
2 - ugguuucacaugguggcuuaga - 23 |
Evidence | experimental; 454 [1], Illumina [1-2] |
Mature sequence tgu-miR-29b-3p |
|
Accession | MIMAT0014601 |
Previous IDs | tgu-miR-29b |
Sequence |
41 - uagcaccauuugaaaucagug - 61 |
Evidence | experimental; 454 [1], Illumina [1-2] |
References |
|
1 |
PMID:20360741
"The genome of a songbird"
Nature. 464:757-762(2010).
|
2 |
PMID:23268654
"Genome-wide annotation and analysis of zebra finch microRNA repertoire reveal sex-biased expression"
BMC Genomics. 13:727(2012).
|