Stem-loop sequence tgu-mir-133-1

AccessionMI0013795 (change log)
DescriptionTaeniopygia guttata miR-133-1 stem-loop
Gene family MIPF0000029; mir-133
Stem-loop
   -------uaa       aa  u  a        accuc 
5'           agcuggu  aa gg accaaauc     u
             |||||||  || || ||||||||      
3'           ucgacca  uu cc ugguuuag     u
   cguaucgaug       ac  c  c        guaac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (taeGlu3.2.4) Overlapping transcripts
chr2: 108161719-108161789 [-]
sense
ENSTGUT00000018351 ; tgu-mir-133-1-201; exon 1
antisense
ENSTGUT00000010786 ; MIB1-201; intron 13
Clustered miRNAs
< 10kb from tgu-mir-133-1
tgu-mir-1-2chr2: 108164864-108164935 [-]
tgu-mir-133-1chr2: 108161719-108161789 [-]
Database links

Mature sequence tgu-miR-133-5p

Accession MIMAT0027005
Sequence

4 - 

agcugguaaaauggaaccaaau

 - 25

Get sequence
Evidence experimental; Illumina [2]

Mature sequence tgu-miR-133-3p

Accession MIMAT0014571
Sequence

41 - 

uuugguccccuucaaccagcu

 - 61

Get sequence
Evidence experimental; 454 [1], Illumina [1-2]

References

1
PMID:20360741 "The genome of a songbird" Warren WC, Clayton DF, Ellegren H, Arnold AP, Hillier LW, Kunstner A, Searle S, White S, Vilella AJ, Fairley S, Heger A, Kong L, Ponting CP, Jarvis ED, Mello CV, Minx P, Lovell P, Velho TA, Ferris M, Balakrishnan CN, Sinha S, Blatti C, London SE, Li Y, Li Nature. 464:757-762(2010).
2
PMID:23268654 "Genome-wide annotation and analysis of zebra finch microRNA repertoire reveal sex-biased expression" Luo GZ, Hafner M, Shi Z, Brown M, Feng GH, Tuschl T, Wang XJ, Li X BMC Genomics. 13:727(2012).