![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence tgu-mir-2989-1 |
||||||
Accession | MI0013736 (change log) | |||||
Description | Taeniopygia guttata miR-2989-1 stem-loop | |||||
Gene family | MIPF0001039; mir-2989 | |||||
Literature search |
1 open access papers mention tgu-mir-2989-1 | |||||
Stem-loop |
-----ca a u agaacuc -ggga g 5' uaugcucagc cg gaug uguuggua caucu a |||||||||| || |||| |||||||| ||||| 3' gugcgggucg gu cuau gcaaccgu guggg g ucauaag a - ------- aagua a |
|||||
Confidence |
Annotation confidence: not enough data
| |||||
Genome context |
|
|||||
Clustered miRNAs |
|
|||||
Database links |
|
Mature sequence tgu-miR-2989 |
|
Accession | MIMAT0014525 |
Sequence |
11 - gcacgugaugagaacucugu - 30 |
Evidence | experimental; 454 [1], Illumina [2] |
References |
|
1 |
PMID:20360741
"The genome of a songbird"
Nature. 464:757-762(2010).
|
2 |
PMID:23268654
"Genome-wide annotation and analysis of zebra finch microRNA repertoire reveal sex-biased expression"
BMC Genomics. 13:727(2012).
|