Stem-loop sequence tgu-let-7e

AccessionMI0013721 (change log)
DescriptionTaeniopygia guttata let-7e stem-loop
Gene family MIPF0000002; let-7
Literature search

1 open access papers mention tgu-let-7e
(1 sentences)

Stem-loop
   ----     g   cu   gu         a      -  --    ucu  u 
5'     uccuu agg  gag  aguagauug auaguu gu  ggag   gg c
       ||||| |||  |||  ||||||||| |||||| ||  ||||   ||  
3'     aggaa ucc  uuc  ucaucuaac uaucaa cg  ucuc   cc c
   acag     -   -u   ug         a      u  ag    ---  u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (taeGlu3.2.4) Overlapping transcripts
chr26: 532984-533075 [-]
sense
ENSTGUT00000018629 ; tgu-let-7e-201; exon 1
Clustered miRNAs
< 10kb from tgu-let-7e
tgu-let-7echr26: 532984-533075 [-]
tgu-let-7a-4chr26: 532798-532889 [-]
Database links

Mature sequence tgu-let-7e-5p

Accession MIMAT0014518
Sequence

11 - 

ugagguaguagauugaauaguu

 - 32

Get sequence
Evidence experimental; 454 [1], Illumina [1-2]

Mature sequence tgu-let-7e-3p

Accession MIMAT0026982
Sequence

61 - 

cuauacaaucuacugucuuucc

 - 82

Get sequence
Evidence experimental; Illumina [2]

References

1
PMID:20360741 "The genome of a songbird" Warren WC, Clayton DF, Ellegren H, Arnold AP, Hillier LW, Kunstner A, Searle S, White S, Vilella AJ, Fairley S, Heger A, Kong L, Ponting CP, Jarvis ED, Mello CV, Minx P, Lovell P, Velho TA, Ferris M, Balakrishnan CN, Sinha S, Blatti C, London SE, Li Y, Li Nature. 464:757-762(2010).
2
PMID:23268654 "Genome-wide annotation and analysis of zebra finch microRNA repertoire reveal sex-biased expression" Luo GZ, Hafner M, Shi Z, Brown M, Feng GH, Tuschl T, Wang XJ, Li X BMC Genomics. 13:727(2012).