Stem-loop sequence tgu-mir-7-1

AccessionMI0013704 (change log)
DescriptionTaeniopygia guttata miR-7-1 stem-loop
Gene family MIPF0000022; mir-7
Literature search

1 open access papers mention tgu-mir-7-1
(5 sentences)

Stem-loop 
   uaguucugu    a     a       u      uu  gau 
5'          gugg agacu gugauuu guuguu  uu   a
            |||| ||||| ||||||| ||||||  ||    
3'          uacc ucuga cacuaaa caacag  aa   a
   ---------    g     -       -      uu  auc
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (taeGlu3.2.4) Overlapping transcripts
chrZ: 52731915-52731987 [+]
sense
ENSTGUT00000018493 ; tgu-mir-7-1-201; exon 1
ENSTGUT00000003277 ; HNRNPK-201; intron 19
Database links

Mature sequence tgu-miR-7-5p

Accession MIMAT0014510
Previous IDstgu-miR-7
Sequence

11 -  

uggaagacuagugauuuuguugu

 - 33

Get sequence
Evidence experimental; 454 [1], Illumina [1-2]

Mature sequence tgu-miR-7-1-3p

Accession MIMAT0014632
Previous IDstgu-miR-7*
Sequence

53 -  

caacaaaucacagucugccau

 - 73

Get sequence
Evidence experimental; 454 [1], Illumina [1]

References

1
PMID:20360741 "The genome of a songbird" Warren WC, Clayton DF, Ellegren H, Arnold AP, Hillier LW, Kunstner A, Searle S, White S, Vilella AJ, Fairley S, Heger A, Kong L, Ponting CP, Jarvis ED, Mello CV, Minx P, Lovell P, Velho TA, Ferris M, Balakrishnan CN, Sinha S, Blatti C, London SE, Li Y, Li Nature. 464:757-762(2010).
2
PMID:23268654 "Genome-wide annotation and analysis of zebra finch microRNA repertoire reveal sex-biased expression" Luo GZ, Hafner M, Shi Z, Brown M, Feng GH, Tuschl T, Wang XJ, Li X BMC Genomics. 13:727(2012).