![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence tgu-mir-7-1 |
|||||
Accession | MI0013704 (change log) | ||||
Description | Taeniopygia guttata miR-7-1 stem-loop | ||||
Gene family | MIPF0000022; mir-7 | ||||
Literature search |
1 open access papers mention tgu-mir-7-1 | ||||
Stem-loop |
uaguucugu a a u uu gau 5' gugg agacu gugauuu guuguu uu a |||| ||||| ||||||| |||||| || 3' uacc ucuga cacuaaa caacag aa a --------- g - - uu auc |
||||
Confidence |
Annotation confidence: not enough data
| ||||
Genome context |
|
||||
Database links |
|
Mature sequence tgu-miR-7-5p |
|
Accession | MIMAT0014510 |
Previous IDs | tgu-miR-7 |
Sequence |
11 - uggaagacuagugauuuuguugu - 33 |
Evidence | experimental; 454 [1], Illumina [1-2] |
Mature sequence tgu-miR-7-1-3p |
|
Accession | MIMAT0014632 |
Previous IDs | tgu-miR-7* |
Sequence |
53 - caacaaaucacagucugccau - 73 |
Evidence | experimental; 454 [1], Illumina [1] |
References |
|
1 |
PMID:20360741
"The genome of a songbird"
Nature. 464:757-762(2010).
|
2 |
PMID:23268654
"Genome-wide annotation and analysis of zebra finch microRNA repertoire reveal sex-biased expression"
BMC Genomics. 13:727(2012).
|