Stem-loop sequence tgu-let-7b

AccessionMI0013703 (change log)
DescriptionTaeniopygia guttata let-7b stem-loop
Gene family MIPF0000002; let-7
Literature search

1 open access papers mention tgu-let-7b
(1 sentences)

Stem-loop 
   ucuaa    au                     ucaggguagugauuu 
5'      cagg  gagguaguagguugugugguu               u
        ||||  |||||||||||||||||||||                
3'      gucc  uuccgucauccaacauaucaa               g
   ---ua    -c                     uagaggacuaacccc
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (taeGlu3.2.4) Overlapping transcripts
chr1A: 61564105-61564196 [-]
intergenic
Clustered miRNAs
< 10kb from tgu-let-7b
tgu-let-7a-1chr1A: 61564945-61565036 [-]
tgu-let-7bchr1A: 61564105-61564196 [-]
Database links

Mature sequence tgu-let-7b-5p

Accession MIMAT0014509
Sequence

11 -  

ugagguaguagguugugugguu

 - 32

Get sequence
Evidence experimental; 454 [1], Illumina [2]

Mature sequence tgu-let-7b-3p

Accession MIMAT0026975
Sequence

67 -  

cuauacaaccuacugccuucc

 - 87

Get sequence
Evidence experimental; Illumina [2]

References

1
PMID:20360741 "The genome of a songbird" Warren WC, Clayton DF, Ellegren H, Arnold AP, Hillier LW, Kunstner A, Searle S, White S, Vilella AJ, Fairley S, Heger A, Kong L, Ponting CP, Jarvis ED, Mello CV, Minx P, Lovell P, Velho TA, Ferris M, Balakrishnan CN, Sinha S, Blatti C, London SE, Li Y, Li Nature. 464:757-762(2010).
2
PMID:23268654 "Genome-wide annotation and analysis of zebra finch microRNA repertoire reveal sex-biased expression" Luo GZ, Hafner M, Shi Z, Brown M, Feng GH, Tuschl T, Wang XJ, Li X BMC Genomics. 13:727(2012).