Stem-loop sequence tgu-mir-9-1

AccessionMI0013692 (change log)
DescriptionTaeniopygia guttata miR-9-1 stem-loop
Gene family MIPF0000014; mir-9
Literature search

3 open access papers mention tgu-mir-9-1
(5 sentences)

Stem-loop
   gauguuu   uc               g     gu   g 
5'        cug  uuugguuaucuagcu uauga  guu u
          |||  ||||||||||||||| |||||  |||  
3'        gau  aagccaauagaucga auacu  cga g
   -------   ga               a     ac   g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (taeGlu3.2.4) Overlapping transcripts
chr10: 12969737-12969809 [-]
sense
ENSTGUT00000018593 ; tgu-mir-9-1-201; exon 1
Database links

Mature sequence tgu-miR-9-5p

Accession MIMAT0014502
Previous IDstgu-miR-9
Sequence

11 - 

ucuuugguuaucuagcuguauga

 - 33

Get sequence
Evidence experimental; 454 [1], Illumina [1-2]

Mature sequence tgu-miR-9-3p

Accession MIMAT0014627
Previous IDstgu-miR-9*
Sequence

50 - 

auaaagcuagauaaccgaaagu

 - 71

Get sequence
Evidence experimental; 454 [1], Illumina [1-2]

References

1
PMID:20360741 "The genome of a songbird" Warren WC, Clayton DF, Ellegren H, Arnold AP, Hillier LW, Kunstner A, Searle S, White S, Vilella AJ, Fairley S, Heger A, Kong L, Ponting CP, Jarvis ED, Mello CV, Minx P, Lovell P, Velho TA, Ferris M, Balakrishnan CN, Sinha S, Blatti C, London SE, Li Y, Li Nature. 464:757-762(2010).
2
PMID:23268654 "Genome-wide annotation and analysis of zebra finch microRNA repertoire reveal sex-biased expression" Luo GZ, Hafner M, Shi Z, Brown M, Feng GH, Tuschl T, Wang XJ, Li X BMC Genomics. 13:727(2012).