Stem-loop sequence tgu-mir-2978

AccessionMI0013676 (change log)
DescriptionTaeniopygia guttata miR-2978 stem-loop
Literature search

1 open access papers mention tgu-mir-2978
(2 sentences)

Stem-loop 
    g   g     -    gaa      -    gu 
5' g ucu ugggc uggg   gggcug cugg  g
   | ||| ||||| ||||   |||||| ||||   
3' c aga gcccg gccc   uccgac gacc  g
    g   -     u    -ac      c    au
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (taeGlu3.2.4) Overlapping transcripts
chr18: 7548428-7548489 [-]
sense
ENSTGUT00000019277 ; SCARNA16-201; exon 1
Database links

Mature sequence tgu-miR-2978

Accession MIMAT0014488
Sequence

6 -  

gugggcuggggaagggcugcugggu

 - 30

Get sequence
Evidence experimental; Illumina [1-2]

References

1
PMID:20360741 "The genome of a songbird" Warren WC, Clayton DF, Ellegren H, Arnold AP, Hillier LW, Kunstner A, Searle S, White S, Vilella AJ, Fairley S, Heger A, Kong L, Ponting CP, Jarvis ED, Mello CV, Minx P, Lovell P, Velho TA, Ferris M, Balakrishnan CN, Sinha S, Blatti C, London SE, Li Y, Li Nature. 464:757-762(2010).
2
PMID:23268654 "Genome-wide annotation and analysis of zebra finch microRNA repertoire reveal sex-biased expression" Luo GZ, Hafner M, Shi Z, Brown M, Feng GH, Tuschl T, Wang XJ, Li X BMC Genomics. 13:727(2012).