Stem-loop sequence bmo-mir-iab-8

AccessionMI0013534 (change log)
Previous IDsbmo-mir-iab-4as
DescriptionBombyx mori miR-iab-8 stem-loop
Gene family MIPF0000854; mir-iab-8
Stem-loop
        au       u            g    a  g  -caa a 
5' guguc  cuucugu acguauacugaa guau cc ga    g a
   |||||  ||||||| |||||||||||| |||| || ||    | u
3' cgcag  gaagaca ugcauaugacuu caua gg cu    c c
        cg       -            a    -  a  cacg g 
Get sequence
Deep sequencing
521 reads, 66.7 reads per million, 3 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM15162v1; GCA_000151625.1) Overlapping transcripts
NW_004582018.1: 3486590-3486677 [-]
intergenic
Clustered miRNAs
< 10kb from bmo-mir-iab-8
bmo-mir-iab-4NW_004582018.1: 3486590-3486677 [+]
bmo-mir-iab-8NW_004582018.1: 3486590-3486677 [-]
Database links

Mature sequence bmo-miR-iab-8

Accession MIMAT0014327
Previous IDsbmo-miR-iab-4as
Sequence

14 - 

uuacguauacugaagguauaccg

 - 36

Get sequence
Deep sequencing521 reads, 3 experiments
Evidence experimental; RTPCR [1]

References

1
PMID:19823945 "Computational identification and characteristics of novel microRNAs from the silkworm (Bombyx mori L.)" Huang Y, Zou Q, Tang SM, Wang LG, Shen XJ Mol Biol Rep. 37:3171-3176(2010).