Stem-loop sequence csi-MIR390a

AccessionMI0013317 (change log)
DescriptionCitrus sinensis miR390a stem-loop
Gene family MIPF0000101; MIR390
Literature search

2 open access papers mention csi-MIR390a
(10 sentences)

Stem-loop
   --------------------aa     a      u    u          g           ugg     augaauauggga    ucu 
5'                       aguaa gaagaa cugu aagcucagga ggauagcgcca   gugcc            auga   a
                         ||||| |||||| |||| |||||||||| |||||||||||   |||||            ||||   g
3'                       ucauu cuucuu ggua uuugaguccu ccuaucgcggu   cacgg            uacu   g
   cucggcuagagcucucucucuc     -      c    c          a           ---     -guaauaaauag    uug 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Csi_valencia_1.0; GCA_000317415.1) Overlapping transcripts
chr6: 11038360-11038515 [+]
intergenic
Database links

Mature sequence csi-miR390a-5p

Accession MIMAT0014092
Sequence

21 - 

aagcucaggagggauagcgcc

 - 41

Get sequence
Evidence experimental; Illumina [2-3]

Mature sequence csi-miR390a-3p

Accession MIMAT0037374
Sequence

99 - 

cgcuauccauccugaguuuca

 - 119

Get sequence
Evidence experimental; Illumina [3]

References

1
PMID:19585144 "Identification and characterization of 27 conserved microRNAs in citrus" Song C, Fang J, Li X, Liu H, Thomas Chao C Planta. 230:671-685(2009).
2
PMID:20398412 "Discovery and comparative profiling of microRNAs in a sweet orange red-flesh mutant and its wild type" Xu Q, Liu Y, Zhu A, Wu X, Ye J, Yu K, Guo W, Deng X BMC Genomics. 11:246(2010).
3
PMID:28054378 "MicroRNA annotation of plant genomes - Do it right or not at all" Taylor RS, Tarver JE, Foroozani A, Donoghue PC Bioessays. [Epub prior to print](2017).