Stem-loop sequence csi-MIR172a

AccessionMI0013302 (change log)
Previous IDscsi-MIR172
DescriptionCitrus sinensis miR172a stem-loop
Gene family MIPF0000035; MIR172
Literature search

5 open access papers mention csi-MIR172a
(17 sentences)

Stem-loop
   gucaccuuaaaac        c       a        c         a   --    -ucua      aa     c   uuu 
5'              agucguug ucgcugu gcagcguc ucaagauuc cau  gcag     aaggca  agcag aau   u
                |||||||| ||||||| |||||||| ||||||||| |||  ||||     ||||||  ||||| |||    
3'              ucaguaau agcggca cgucguag aguucuaag gug  uguu     uuccgu  ucguu uua   c
   -aacaaccaucga        u       a        u         a   ac    uuugg      --     u   cuu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Csi_valencia_1.0; GCA_000317415.1) Overlapping transcripts
chr1: 27309962-27310123 [-]
intergenic
Database links

Mature sequence csi-miR172a-5p

Accession MIMAT0017387
Previous IDscsi-miR172a*
Sequence

31 - 

gcagcguccucaagauucaca

 - 51

Get sequence
Evidence experimental; Illumina [2-3]

Mature sequence csi-miR172a-3p

Accession MIMAT0014076
Previous IDscsi-miR172;csi-miR172a
Sequence

115 - 

agaaucuugaugaugcugca

 - 134

Get sequence
Evidence experimental; Northern [1], Illumina [2-3]

References

1
PMID:19585144 "Identification and characterization of 27 conserved microRNAs in citrus" Song C, Fang J, Li X, Liu H, Thomas Chao C Planta. 230:671-685(2009).
2
PMID:20398412 "Discovery and comparative profiling of microRNAs in a sweet orange red-flesh mutant and its wild type" Xu Q, Liu Y, Zhu A, Wu X, Ye J, Yu K, Guo W, Deng X BMC Genomics. 11:246(2010).
3
PMID:28054378 "MicroRNA annotation of plant genomes - Do it right or not at all" Taylor RS, Tarver JE, Foroozani A, Donoghue PC Bioessays. [Epub prior to print](2017).