Stem-loop sequence csi-MIR166e

AccessionMI0013296 (change log)
Previous IDscsi-MIR166
DescriptionCitrus sinensis miR166e stem-loop
Gene family MIPF0000004; MIR166
Literature search

7 open access papers mention csi-MIR166e
(12 sentences)

Stem-loop
   -g      uuuu   u   a        uu      cu   g   acugcuuguugauccauuaauuuuacguauucucucauagaucu 
5'   gggagc    ugu uug ggggaaug  gucugg  cga gac                                            a
     ||||||    ||| ||| ||||||||  ||||||  ||| |||                                             
3'   ccuucg    aua aac ccccuuac  cggacc  gcu cug                                            g
   ua      --uu   u   c        uu      ag   g   cgguuuauucgacuuaggcauauaacaauaggugguaagucuac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Csi_valencia_1.0; GCA_000317415.1) Overlapping transcripts
JH999119.1: 2541222-2541398 [+]
intergenic
Database links

Mature sequence csi-miR166e-5p

Accession MIMAT0017386
Previous IDscsi-miR166e*
Sequence

22 - 

ggaauguugucuggcucgagg

 - 42

Get sequence
Evidence experimental; Illumina [2-3]

Mature sequence csi-miR166e-3p

Accession MIMAT0014070
Previous IDscsi-miR166;csi-miR166e
Sequence

139 - 

ucggaccaggcuucauucccc

 - 159

Get sequence
Evidence experimental; Illumina [2-3]

References

1
PMID:19585144 "Identification and characterization of 27 conserved microRNAs in citrus" Song C, Fang J, Li X, Liu H, Thomas Chao C Planta. 230:671-685(2009).
2
PMID:20398412 "Discovery and comparative profiling of microRNAs in a sweet orange red-flesh mutant and its wild type" Xu Q, Liu Y, Zhu A, Wu X, Ye J, Yu K, Guo W, Deng X BMC Genomics. 11:246(2010).
3
PMID:28054378 "MicroRNA annotation of plant genomes - Do it right or not at all" Taylor RS, Tarver JE, Foroozani A, Donoghue PC Bioessays. [Epub prior to print](2017).