![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence csi-MIR164a |
|||||
Accession | MI0013295 (change log) | ||||
Description | Citrus sinensis miR164a stem-loop | ||||
Gene family | MIPF0000045; MIR164 | ||||
Literature search |
![]()
6 open access papers mention csi-MIR164a | ||||
Stem-loop |
---------------------------------------------guguagagcaa a c cauuac cgcacauacau c aaauuaauuaauccacacauuuugaaga 5' gaugg gaag agggcacgug uaacucaac cua uaacaa a ||||| |||| |||||||||| ||||||||| ||| |||||| a 3' cuacc cuuc ucccguguac auugaguug gau auuguu c gucuagaacucgacuagggacuacuauguguguguguguguuccacggcgccagua c u uucuuu aguacugacuc - gucuuucucguacgacgaagaacuaaac |
||||
Confidence |
Annotation confidence: not enough data
| ||||
Genome context |
|
||||
Database links |
|
Mature sequence csi-miR164a-5p |
|
Accession | MIMAT0014069 |
Sequence |
14 - uggagaagcagggcacgugca - 34 |
Evidence | experimental; Northern [1], Illumina [2-3] |
Mature sequence csi-miR164a-3p |
|
Accession | MIMAT0037371 |
Sequence |
163 - caugugcccuucuuccccauc - 183 |
Evidence | experimental; Illumina [3] |
References |
|
1 |
PMID:19585144
"Identification and characterization of 27 conserved microRNAs in citrus"
Planta. 230:671-685(2009).
|
2 |
PMID:20398412
"Discovery and comparative profiling of microRNAs in a sweet orange red-flesh mutant and its wild type"
BMC Genomics. 11:246(2010).
|
3 |
PMID:28054378
"MicroRNA annotation of plant genomes - Do it right or not at all"
Bioessays. [Epub prior to print](2017).
|