Stem-loop sequence csi-MIR164a

AccessionMI0013295 (change log)
DescriptionCitrus sinensis miR164a stem-loop
Gene family MIPF0000045; MIR164
Literature search

6 open access papers mention csi-MIR164a
(41 sentences)

Stem-loop
   ---------------------------------------------guguagagcaa     a    c          cauuac         cgcacauacau   c      aaauuaauuaauccacacauuuugaaga 
5'                                                         gaugg gaag agggcacgug      uaacucaac           cua uaacaa                            a
                                                           ||||| |||| ||||||||||      |||||||||           ||| ||||||                            a
3'                                                         cuacc cuuc ucccguguac      auugaguug           gau auuguu                            c
   gucuagaacucgacuagggacuacuauguguguguguguguuccacggcgccagua     c    u          uucuuu         aguacugacuc   -      gucuuucucguacgacgaagaacuaaac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Csi_valencia_1.0; GCA_000317415.1) Overlapping transcripts
chr6: 11293723-11293961 [+]
intergenic
Database links

Mature sequence csi-miR164a-5p

Accession MIMAT0014069
Sequence

14 - 

uggagaagcagggcacgugca

 - 34

Get sequence
Evidence experimental; Northern [1], Illumina [2-3]

Mature sequence csi-miR164a-3p

Accession MIMAT0037371
Sequence

163 - 

caugugcccuucuuccccauc

 - 183

Get sequence
Evidence experimental; Illumina [3]

References

1
PMID:19585144 "Identification and characterization of 27 conserved microRNAs in citrus" Song C, Fang J, Li X, Liu H, Thomas Chao C Planta. 230:671-685(2009).
2
PMID:20398412 "Discovery and comparative profiling of microRNAs in a sweet orange red-flesh mutant and its wild type" Xu Q, Liu Y, Zhu A, Wu X, Ye J, Yu K, Guo W, Deng X BMC Genomics. 11:246(2010).
3
PMID:28054378 "MicroRNA annotation of plant genomes - Do it right or not at all" Taylor RS, Tarver JE, Foroozani A, Donoghue PC Bioessays. [Epub prior to print](2017).