Stem-loop sequence osa-MIR2927

AccessionMI0013269 (change log)
DescriptionOryza sativa miR2927 stem-loop
Literature search

1 open access papers mention osa-MIR2927
(1 sentences)

Stem-loop
   ----ug       c  c ag   gaag         auguc        acuugucgucgucgauggagcccaugaagcgu 
5'       ucgcggc gg g  cau    cugacgacg     gcggaggu                                g
         ||||||| || |  |||    |||||||||     ||||||||                                 
3'       agcgccg cc c  gua    ggcuguugc     cgccuucg                                a
   ugcgcg       -  u ca   ----         -----        aaccgccgcgacgguggccgucgcuggaggaa 
Get sequence
Deep sequencing
10 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr1: 37098081-37098230 [+]
intergenic
Database links

Mature sequence osa-miR2927

Accession MIMAT0014058
Sequence

49 - 

ugucgucgucgauggagcccaug

 - 71

Get sequence
Evidence experimental; cloned [1]

References

1
PMID:20131478 "Cloning and validation of novel miRNA from basmati rice indicates cross talk between abiotic and biotic stresses" Sanan-Mishra N, Kumar V, Sopory SK, Mukherjee SK Mol Genet Genomics. 282:463-474(2009).