Stem-loop sequence eca-mir-505

AccessionMI0012974 (change log)
DescriptionEquus caballus miR-505 stem-loop
Gene family MIPF0000217; mir-505
Literature search

1 open access papers mention eca-mir-505
(4 sentences)

Stem-loop
        ac    u           g    a        ucug 
5' gaugc  ccag gggggagccag aagu uugauguu    c
   |||||  |||| ||||||||||| |||| ||||||||    c
3' cuacg  gguc cuccuuugguc uuca aacugcga    a
        -a    u           g    c        uuug 
Get sequence
Deep sequencing
101 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EquCab2.0; GCF_000002305.2) Overlapping transcripts
chrX: 111378309-111378392 [-]
intergenic
Database links

Mature sequence eca-miR-505

Accession MIMAT0013229
Sequence

51 - 

cgucaacacuugcugguuuccu

 - 72

Get sequence
Deep sequencing91 reads, 1 experiments
Evidence not experimental

References

1
PMID:19406225 "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y Genomics. 94:125-131(2009).