Stem-loop sequence eca-mir-374a

AccessionMI0012959 (change log)
DescriptionEquus caballus miR-374a stem-loop
Gene family MIPF0000288; mir-374
Literature search

2 open access papers mention eca-mir-374a
(2 sentences)

Stem-loop
        c   c                        u 
5' uacau ggc auuauaauacaaccugauaagugu a
   ||||| ||| ||||||||||||||||||||||||  
3' augug cug uaauguuauguuggacuauucacg c
        u   u                        a 
Get sequence
Deep sequencing
1970 reads, 100 reads per million, 2 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EquCab2.0; GCF_000002305.2) Overlapping transcripts
chrX: 55500596-55500667 [-]
intergenic
Clustered miRNAs
< 10kb from eca-mir-374a
eca-mir-374achrX: 55500596-55500667 [-]
eca-mir-545chrX: 55500412-55500517 [-]
Database links

Mature sequence eca-miR-374a

Accession MIMAT0013213
Sequence

12 - 

uuauaauacaaccugauaagug

 - 33

Get sequence
Deep sequencing1135 reads, 1 experiments
Evidence not experimental

References

1
PMID:19406225 "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y Genomics. 94:125-131(2009).