Stem-loop sequence eca-mir-222

AccessionMI0012952 (change log)
DescriptionEquus caballus miR-222 stem-loop
Gene family MIPF0000051; mir-221
Literature search

1 open access papers mention eca-mir-222
(6 sentences)

Stem-loop
   gcu      aagugu    a  c   au              -     auc   ucuu 
5'    gcugga      aggu cc uca  ggcucaguagccag uguag   cug    u
      ||||||      |||| || |||  |||||||||||||| |||||   |||    u
3'    cgaucu      ucua gg agu  cugggucaucgguc acauc   gac    g
   --u      ------    c  u   cu              u     gac   uaau 
Get sequence
Deep sequencing
678 reads, 50 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EquCab2.0; GCF_000002305.2) Overlapping transcripts
chrX: 37091426-37091535 [-]
intergenic
Clustered miRNAs
< 10kb from eca-mir-222
eca-mir-222chrX: 37091426-37091535 [-]
eca-mir-221chrX: 37090647-37090756 [-]
Database links

Mature sequence eca-miR-222

Accession MIMAT0013204
Sequence

69 - 

agcuacaucuggcuacugggu

 - 89

Get sequence
Deep sequencing678 reads, 1 experiments
Evidence not experimental

References

1
PMID:19406225 "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y Genomics. 94:125-131(2009).