Stem-loop sequence eca-mir-135a-2

AccessionMI0012933 (change log)
DescriptionEquus caballus miR-135a-2 stem-loop
Gene family MIPF0000028; mir-135
Literature search

2 open access papers mention eca-mir-135a-2
(13 sentences)

Stem-loop
   a   aaa     ucua   c            u            u g a 
5'  gau   uucac    gug uuuauggcuuuu auuccuauguga a u a
    |||   |||||    ||| |||||||||||| |||||||||||| | | u
3'  cua   aagug    cau aaguaccgaagg uagggauguacu u a a
   a   -aa     -uua   a            -            c g a 
Get sequence
Deep sequencing
270 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EquCab2.0; GCF_000002305.2) Overlapping transcripts
chr28: 22270398-22270497 [+]
intergenic
Database links

Mature sequence eca-miR-135a

Accession MIMAT0013078
Sequence

23 - 

uauggcuuuuuauuccuauguga

 - 45

Get sequence
Deep sequencing525 reads, 1 experiments
Evidence not experimental

References

1
PMID:19406225 "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y Genomics. 94:125-131(2009).