Stem-loop sequence eca-mir-433

AccessionMI0012902 (change log)
DescriptionEquus caballus miR-433 stem-loop
Gene family MIPF0000177; mir-433
Literature search

2 open access papers mention eca-mir-433
(90 sentences)

Stem-loop
   ------------------------ugcccgg      gua   u           u   --------  g     cu 
5'                                ggagaa   cgg gagccugucau auu        ca agagg  a
                                  ||||||   ||| ||||||||||| |||        || |||||   
3'                                ccucuu   gcu cucggguagua uag        gu ucucc  g
   cccgacggaaguaccacaccacggcgaugga      gug   c           c   gaagaauu  g     ua 
Get sequence
Deep sequencing
100 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EquCab2.0; GCF_000002305.2) Overlapping transcripts
chr24: 42745895-42746018 [+]
antisense
ENSECAT00000005871 ; eca-mir-433-201; exon 1
Clustered miRNAs
< 10kb from eca-mir-433
eca-mir-337chr24: 42738909-42739000 [+]
eca-mir-431chr24: 42745020-42745108 [+]
eca-mir-433chr24: 42745895-42746018 [+]
eca-mir-127chr24: 42747005-42747074 [+]
eca-mir-432chr24: 42748485-42748573 [+]
eca-mir-136chr24: 42748685-42748746 [+]
Database links

Mature sequence eca-miR-433

Accession MIMAT0013158
Sequence

67 - 

aucaugaugggcuccucggugu

 - 88

Get sequence
Deep sequencing88 reads, 1 experiments
Evidence not experimental

References

1
PMID:19406225 "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y Genomics. 94:125-131(2009).