Stem-loop sequence eca-mir-376b

AccessionMI0012889 (change log)
DescriptionEquus caballus miR-376b stem-loop
Gene family MIPF0000091; mir-368
Stem-loop
   u      u    g      a     u     u   - guga 
5'  gguauu aaaa guggau uuccu cuaug uua c    u
    |||||| |||| |||||| ||||| ||||| ||| |     
3'  cuauga uuuu uaccua aagga gauac aau g    u
   a      c    g      a     -     u   a auac 
Get sequence
Deep sequencing
55 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EquCab2.0; GCF_000002305.2) Overlapping transcripts
chr24: 42911856-42911937 [+]
sense
ENSECAT00000027296 ; eca-mir-376b-201; exon 1
Clustered miRNAs
< 10kb from eca-mir-376b
eca-mir-494chr24: 42902171-42902251 [+]
eca-mir-1193chr24: 42902577-42902697 [+]
eca-mir-543chr24: 42904247-42904318 [+]
eca-mir-495chr24: 42906084-42906165 [+]
eca-mir-3958chr24: 42908032-42908174 [+]
eca-mir-376cchr24: 42911104-42911169 [+]
eca-mir-376bchr24: 42911856-42911937 [+]
eca-mir-376achr24: 42912234-42912301 [+]
eca-mir-1185chr24: 42914351-42914436 [+]
eca-mir-381chr24: 42916054-42916128 [+]
eca-mir-487bchr24: 42916520-42916603 [+]
eca-mir-539chr24: 42917365-42917442 [+]
eca-mir-889chr24: 42917940-42918017 [+]
eca-mir-544-2chr24: 42918692-42918781 [+]
eca-mir-655chr24: 42919594-42919690 [+]
eca-mir-3959chr24: 42921540-42921650 [+]
Database links

Mature sequence eca-miR-376b

Accession MIMAT0013144
Sequence

51 - 

aucauagaggaaaauccaugu

 - 71

Get sequence
Deep sequencing54 reads, 1 experiments
Evidence not experimental

References

1
PMID:19406225 "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y Genomics. 94:125-131(2009).