Stem-loop sequence eca-mir-204b-2

AccessionMI0012862 (change log)
DescriptionEquus caballus miR-204b-2 stem-loop
Gene family MIPF0000042; mir-204
Literature search

2 open access papers mention eca-mir-204b-2
(10 sentences)

Stem-loop
   u    u          a     u    gagaau 
5'  ggac ucccuuuguc uccua gccu      a
    |||| |||||||||| ||||| ||||      u
3'  cuug agggaaacgg agggu cgga      a
   a    c          a     -    ggaagu 
Get sequence
Deep sequencing
7090 reads, 400 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EquCab2.0; GCF_000002305.2) Overlapping transcripts
chr23: 20137064-20137131 [+]
sense
ENSECAT00000028567 ; eca-mir-204b-2-201; exon 1
ENSECAT00000009675 ; TRPM3-202; intron 6
ENSECAT00000009560 ; TRPM3-201; intron 7
Database links

Mature sequence eca-miR-204b

Accession MIMAT0013112
Sequence

6 - 

uucccuuugucauccuaugccu

 - 27

Get sequence
Deep sequencing7088 reads, 1 experiments
Evidence not experimental

References

1
PMID:19406225 "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y Genomics. 94:125-131(2009).