Stem-loop sequence eca-mir-133a-2

AccessionMI0012856 (change log)
DescriptionEquus caballus miR-133a-2 stem-loop
Gene family MIPF0000029; mir-133
Literature search

4 open access papers mention eca-mir-133a-2
(8 sentences)

Stem-loop
       a       aa  u  a        aacug 
5' gcua agcuggu  aa gg accaaauc     u
   |||| |||||||  || || ||||||||      
3' cgau ucgacca  uu cc ugguuuag     u
       g       ac  c  c        guaac 
Get sequence
Deep sequencing
1590 reads, 100 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EquCab2.0; GCF_000002305.2) Overlapping transcripts
chr22: 48444266-48444333 [+]
sense
ENSECAT00000027499 ; eca-mir-133a-2-201; exon 1
Database links

Mature sequence eca-miR-133a

Accession MIMAT0012997
Sequence

43 - 

uuugguccccuucaaccagcug

 - 64

Get sequence
Deep sequencing3172 reads, 1 experiments
Evidence not experimental

References

1
PMID:19406225 "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y Genomics. 94:125-131(2009).