Stem-loop sequence eca-mir-449a

AccessionMI0012851 (change log)
DescriptionEquus caballus miR-449a stem-loop
Gene family MIPF0000133; mir-449
Literature search

2 open access papers mention eca-mir-449a
(2 sentences)

Stem-loop
          gua            uga  au 
5' uggcagu   uuguuagcuggu   au  a
   |||||||   ||||||||||||   ||   
3' aucguca   aacaaucgacua   ua  u
          acg            cgg  ag 
Get sequence
Deep sequencing
16585 reads, 1.1e+03 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EquCab2.0; GCF_000002305.2) Overlapping transcripts
chr21: 17151965-17152024 [+]
sense
ENSECAT00000017780 ; CDC20B-201; intron 2
Clustered miRNAs
< 10kb from eca-mir-449a
eca-mir-449bchr21: 17151814-17151938 [+]
eca-mir-449achr21: 17151965-17152024 [+]
Database links

Mature sequence eca-miR-449a

Accession MIMAT0013102
Sequence

1 - 

uggcaguguauuguuagcuggu

 - 22

Get sequence
Deep sequencing16580 reads, 1 experiments
Evidence not experimental

References

1
PMID:19406225 "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y Genomics. 94:125-131(2009).