Stem-loop sequence eca-mir-874

AccessionMI0012813 (change log)
DescriptionEquus caballus miR-874 stem-loop
Gene family MIPF0000401; mir-874
Literature search

1 open access papers mention eca-mir-874
(1 sentences)

Stem-loop
   g   c   a  ca        a   -a a 
5'  cgg ccc cg  ccagggua gag  g c
    ||| ||| ||  |||||||| |||  | u
3'  gcc ggg gc  ggucccgu cuu  c c
   a   a   a  cc        c   cg u 
Get sequence
Deep sequencing
213 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EquCab2.0; GCF_000002305.2) Overlapping transcripts
chr14: 38723804-38723863 [+]
sense
ENSECAT00000028552 ; eca-mir-874-201; exon 1
ENSECAT00000023668 ; KLHL3-201; intron 8
Database links

Mature sequence eca-miR-874

Accession MIMAT0013069
Sequence

39 - 

cugcccuggcccgagggaccga

 - 60

Get sequence
Deep sequencing101 reads, 1 experiments
Evidence not experimental

References

1
PMID:19406225 "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y Genomics. 94:125-131(2009).